|
Sangon Biotech
accttccaggatgaggacatga sangon biotech n a il1b primer Accttccaggatgaggacatga Sangon Biotech N A Il1b Primer, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/il+1+b/pm38159573-806-200-201?v=Sangon+Biotech Average 86 stars, based on 1 article reviews
accttccaggatgaggacatga sangon biotech n a il1b primer - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
|
Boster Bio
rabbit anti il 1β Rabbit Anti Il 1β, supplied by Boster Bio, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/il+1+b/pmc12812623-87-43-48?v=Boster+Bio Average 93 stars, based on 1 article reviews
rabbit anti il 1β - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
|
Proteintech
il 6 ![]() Il 6, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/il+1+b/pmc12990394-76-3-9?v=Proteintech Average 96 stars, based on 1 article reviews
il 6 - by Bioz Stars,
2026-08
96/100 stars
|
Buy from Supplier |
|
Beijing Solarbio Science
recombinant human il1b ![]() Recombinant Human Il1b, supplied by Beijing Solarbio Science, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/il+1+b/pmc12497865-54-33-36?v=Beijing+Solarbio+Science Average 93 stars, based on 1 article reviews
recombinant human il1b - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
|
Proteintech
il 1β ![]() Il 1β, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/il+1+b/pmc11450254__MCO2___5___e728___s001-19-21-22?v=Proteintech Average 96 stars, based on 1 article reviews
il 1β - by Bioz Stars,
2026-08
96/100 stars
|
Buy from Supplier |
|
Thermo Fisher
gene exp il1b hs00174097 m1 ![]() Gene Exp Il1b Hs00174097 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/il+1+b/pm41898728-261-47-72?v=Thermo+Fisher Average 99 stars, based on 1 article reviews
gene exp il1b hs00174097 m1 - by Bioz Stars,
2026-08
99/100 stars
|
Buy from Supplier |
|
Thermo Fisher
gene exp il1b mm01336189 m1 ![]() Gene Exp Il1b Mm01336189 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/il+1+b/bio_rxiv__64898__2026__03__02__709037-38-22-10?v=Thermo+Fisher Average 99 stars, based on 1 article reviews
gene exp il1b mm01336189 m1 - by Bioz Stars,
2026-08
99/100 stars
|
Buy from Supplier |
|
Thermo Fisher
gene exp il1b mm00434228 m1 ![]() Gene Exp Il1b Mm00434228 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/il+1+b/pm34591647-107-21--1?v=Thermo+Fisher Average 99 stars, based on 1 article reviews
gene exp il1b mm00434228 m1 - by Bioz Stars,
2026-08
99/100 stars
|
Buy from Supplier |
|
Miltenyi Biotec
apc anti il 1b ![]() Apc Anti Il 1b, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/il+1+b/pm37822935-234-42-46?v=Miltenyi+Biotec Average 93 stars, based on 1 article reviews
apc anti il 1b - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
|
Kingfisher Biotech
recombinant bovine il 1β ![]() Recombinant Bovine Il 1β, supplied by Kingfisher Biotech, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/il+1+b/pmc12580949-76-41-44?v=Kingfisher+Biotech Average 94 stars, based on 1 article reviews
recombinant bovine il 1β - by Bioz Stars,
2026-08
94/100 stars
|
Buy from Supplier |
|
OriGene
primers ![]() Primers, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/il+1+b/pm23226286-134-43-37?v=OriGene Average 90 stars, based on 1 article reviews
primers - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
OriGene
interleukin 1β antibody ta506440 ![]() Interleukin 1β Antibody Ta506440, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/il+1+b/pmc12080364-54-81-84?v=OriGene Average 93 stars, based on 1 article reviews
interleukin 1β antibody ta506440 - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
Image Search Results
Journal: BMC Gastroenterology
Article Title: Inhibition of TLR4 enhances oxaliplatin chemotherapy sensitivity in esophageal squamous cell carcinoma by suppressing inflammation and glycolysis
doi: 10.1186/s12876-026-04663-2
Figure Lengend Snippet: OXA activated TLR4 signaling in ESCC cells. The cells were treated by OXA (25 µM) for 24 h. A , B . The mRNA expressions of TLR4 and MYD88 in ESCC cell lines and normal esophageal cells were detected by qRT-PCR. C . ICC showed the immunocytochemical activity of NF-κB p65, p-NF-κB p65, COX-2, and MYD88. Scale bar: 50 μm. D . qRT-PCR analysis of mRNA levels of IL-1β, IL-6, COX-2, CXCL5, and CXCL8. *p < 0.05, **p < 0.01, ***p < 0.001 vs. Control group
Article Snippet: Serum concentrations of
Techniques: Quantitative RT-PCR, Activity Assay, Control
Journal: BMC Gastroenterology
Article Title: Inhibition of TLR4 enhances oxaliplatin chemotherapy sensitivity in esophageal squamous cell carcinoma by suppressing inflammation and glycolysis
doi: 10.1186/s12876-026-04663-2
Figure Lengend Snippet: TLR4 knockout enhances the sensitivity of OXA chemotherapy in ESCC in vivo. A . Number of tumors. B . HE staining of esophageal epithelial tissues. Scale bar: 50 μm. C . Body weight of mice. D , E . the levels of serum IL-1β and IL-6 in mice from different groups were detected by ELISA. F . The immunohistochemical activities of PCNA, CK14, Cyclin D1, COX-2, S100A8 and S100A9 in the esophageal tissue were detected. Scale bar: 100 μm. G , H . The mRNA levels of inflammatory cytokines and glycolysis-related proteins in esophageal tissue were detected by qRT-PCR. * p < 0.05, ** p < 0.01, *** p < 0.001 vs. WT group; # p < 0.05, ## p < 0.01, ### p < 0.001 vs. WT + 4NQO + OXA group
Article Snippet: Serum concentrations of
Techniques: Knock-Out, In Vivo, Staining, Enzyme-linked Immunosorbent Assay, Immunohistochemical staining, Quantitative RT-PCR
Journal: BMC Gastroenterology
Article Title: Inhibition of TLR4 enhances oxaliplatin chemotherapy sensitivity in esophageal squamous cell carcinoma by suppressing inflammation and glycolysis
doi: 10.1186/s12876-026-04663-2
Figure Lengend Snippet: Schematic diagram illustrating the mechanism by which TLR4 inhibition enhances oxaliplatin (OXA) chemosensitivity in esophageal squamous cell carcinoma (ESCC). OXA treatment upregulates TLR4 and its downstream adaptor protein MYD88, which activates the phosphorylation of NF-κB p65. This activation drives two parallel pathways: (1) the inflammatory response, characterized by the upregulation of pro-inflammatory factors such as IL-6, COX-2, and CXCL5; (2) the glycolytic metabolic reprogramming, mediated by the HIF-1α/GLUT1 axis and enhanced expression of glycolytic enzymes including PFKM and LDHB. These two pathways synergistically promote ESCC cell proliferation, migration, and invasion, ultimately reducing OXA chemosensitivity. Inhibition of TLR4 (via genetic knockout, shRNA knockdown, or pharmacological inhibitor TAK-242) or its downstream mediator MYD88 (via shRNA knockdown or inhibitor ST2825) blocks NF-κB p65 phosphorylation, thereby suppressing both the inflammatory response and glycolytic activity. This dual inhibition disrupts the adaptive survival mechanisms of ESCC cells, potentiating the anti-tumor efficacy of OXA
Article Snippet: Serum concentrations of
Techniques: Inhibition, Phospho-proteomics, Activation Assay, Expressing, Migration, Knock-Out, shRNA, Knockdown, Activity Assay